Nitrite Reductase (nirK) Gene Sequences

Data in the KBS LTER core database may not be published without written permission of the lead investigator or project director Full terms of use

Gene sequences of the gene encoding nitrite reductase (nirK) were determined in soil samples taken from the Main Cropping System Experiment.

This datatable is part of the Soil Microbial Gene Sequences dataset. Gene sequences extracted from soils.

Note

Experiment: Main Cropping System Experiment (MCSE)
Data available from: December 2004 to July 2010
Dataset: KBS082
Datatable ID: KBS082-001.18
Core Areas Populations,Disturbance
Related Tables:
Personnel:
Last Updated 2017-10-24
Variate Description Units
sample date date of sample collection
treatment LTER treatment
replicate LTER replicate
primer set primer set used to isolate the sequence
sequencing method sequencing method used
gene type of gene
pubmed id pubmed_id for this gene if any
accession gene bank accession id if any
name local lab name of the gene
sequence sequence

Data Excerpt

sample_date treatment replicate primer_set sequencing_method gene pubmed_id accession name sequence
2010-07-02 DF 1 F1aCu and R3Cu Sanger nirK KDAAA07 ATCATGGTGCTGCCGCGCGATGGGCTCAAGGATGCCGCCGGCAAACCTCTCCACTACGACCGGATCTACTATGTCGGCGAGCAAGACTATTACGTTCCGCGCGATGCGAAGGGCAATTTCAAGACCTACGACACGCACATCGACGCCTTTGCGGACACCATGGACGCGATGCGCAAACTCATCCCTACCCATGTTGTGTTCAACGGCAGGGTGGGAGCCTTGACTGGCAAGGACGCGATGCCCGCAAAGGTGGGCGAGACCGTGTTGATCGTGCACTCCCAGGCCGATCGTGACTCGCGTCCGCATCTGGTCGGCGGACACGGCGACTATGTCTGGGAGACCGGCAAATTCTCAAATCCTCCAATGACCAGTCTCGAGACCTGGTTCATTCGCGGCGGCTCTGCCGGCGCAGCGCTCTACACGTTCCTCCAGCCCGGCATCTACGGCTACGTAAACCACAACCTGATCGAGGC
2010-07-02 DF 1 F1aCu and R3Cu Sanger nirK KDAAA09 ATCATGGTGCTGCCGCGCGACGGGCTCAAGGATGCCGCGGGCAAACCTCTCCACTACGATCGGGTCTACTATGTCGGCGAGCAAGACTTTTACGTTCCGCGCGATGCGAAGGGCAATTTCAAGACCTACGACACGCACATCGACGCCTTTGAGGACACCATGGACACGATGCGCAAACTCATCCCTACCCATGTTGTGTTCAACGGCAGGGTGGGAGCCTTGACTGGCAAGGACGCGATGCCCGCAAAGGTGGGCGAGACCGTGCTGATCGTGCACTCCCAGGTCGACCGTGACTCACGTCCGCATCTGGTCGGCGGACACGGCGACTATGTCTGGGAGACCGGCAAATTCTCAAATCCTCCAATGACCAGTCTCGAGACCTGGTTCATTCGCGGCGGCTCTGCCGGCGCAGCGCTCTACACGTTCCTCCAGCCCGGCATCTATGCCTACGTAAACCACAACCTGATCGAGGC
2010-07-02 DF 1 F1aCu and R3Cu Sanger nirK KDAAA12 ATCATGGTGCTGCCGCGAGACGGGCTCAAGAACGAAAAAGGCGAGCCACTGCGCTATGATCGCATCTACTATGTCGGCGAAAACGAGTTCTACATTCCGCGTGACGAGGCCGGAAACTACAAGACATTTGAGTCATTGGGCGAGAGCTACGCCGATACCCTTGCGACCATGCGCGGCTTGATTCCGACCCATGTCGTCTTTAACGGCAAGGTAGGAGCACTGACCGGCGAAAACGCCATGAAGTCCAAGGTCGGCGAGACGGTCCTGATCGTTCACTCACAGGCTATTCGCGACACGCGACCGCATCTGATCGGTGGTCACGGTGACTATGTCTGGGAAGAAGGGAAATTTGCGAATCCGCCCGCCAAGGACCTTGAGACCTGGTTCATCCGCGGCGGGTCAGCCGGGGCGGCGCTGTATACGTTTCTGCAGCCCGGCATCTATGCCTATGTGAACCACAACCTGATCGAGGC
2010-07-02 DF 1 F1aCu and R3Cu Sanger nirK KDAAB08 ATCATGGTGCTGCCGCGTGATGGCCTCAGGAACGACAAGGGCGAACCGGTCGAGTACGACAGGATCTTCTATATCGGCGAGAACGACTTCTATATCCCGCGTGACGACCAAGGTAACTTCAAGAGCTACGAATCGGCCGGCGATGGCTACGACGACGTCGTCAAGGTGATGCGCGGGCTGATCCCGACGCATGTGGTGTTCAACGGCAAGGTCGGGTCGCTGACCGGCGACAACGCGATGAAAGCGACAGTGGGCGAAACAGTACTGATCGTCCATTCGCAGGCCAACCGCGATACACGGCCGCATCTGATCGGTGGACACGGCGACTATGTCTGGGAACAAGGCAAATTCGCCAATCCGCCTGCCAAGGATCTGGAAACCTGGTTCATCCGTGGTGGCTCGGCCGGCTCGGCGCTCTATACGTTCCTGCAGCCGGGTATCTACGCCTACGTCAACCACAACCTGATCGAGGC
2010-07-02 DF 1 F1aCu and R3Cu Sanger nirK KDAAC08 ATCATGGTGCTGCCGCGCGACGGATTGAAAGACCATCTGGGGCAGCCCGTCAGCTATGACCGCATATACTATATCGGCGAGACTGACTTTTACATCCCGAAGGGCAAGGACGGAGCCTATATGCGCTTTGCCGATGCCGGGGAAAGCTACTCGGACGTGCTCGAAGTGATGAACGGGCTGATCCCGTCGCATGTGGTATTCAACGGCAAGGTGGGTGCCCTGACTGGCGACAATGCCCTGACAGCCGATCAAGGCGAGACTGTGCTCTTCGTCCACAGCCAGGCCAACCGCGACAGCCGCCCCCACCTGATCGGTGGGCATGGCGATCTGGTCTGGGAGGCGGGCAAGTTCAATAACGTGCCGGATCGCGATCTGGAAACCTGGTTCATCCGGGGCGGCTCGGCGGGCGCGGCGCTTTATACGTTCCTGCAACCAGGCGTCTATGCCTACGTCAACCACAATCTGATCGAGGC
Back to Data Catalog   EML formatted metadata
Sign In