Nitrite Reductase (nirK) Gene Sequences

Gene sequences of the gene encoding nitrite reductase (nirK) extracted from soils of the Biodiversity Gradient Experiment at the LTER Main Site.

This datatable is part of the Soil Microbial Gene Sequences dataset. Gene sequences extracted from soils.

Note

Experiment: Biodiversity Gradient Experiment
Data available from: November 2009
Dataset: KBS082
Datatable ID: KBS082-002.18
Core Areas Populations,Disturbance
Related Tables:
Personnel:
Last Updated 2013-05-07
Variate Description Units
sample date date of sample collection
plot LTER treatment- replicate
schmidt lab ID unique sequence identifier used by Tom Schmidt's lab
sequence gene sequence

Data Excerpt

sample_date plot schmidt_lab_id sequence
2009-11-17 B03a 001C ATCATGGTGCTGCCGCGCGAGGGGCTCGCCGATGGCCACGGGAAGCCGATCGTCTACGACAAGGTCTACTACGTCGGCGAGCAGGACTTCTACATCCCGCGGGACGAGACCGGTAAGTTCAAGAAGTACGACAGCCCCGGCGAAGCATACGAGGATACCATCGCCGTGATGAAGACGCTGACCCCGACGCACATCGTTTTCAATGGCGCCGTCGGGGCGCTGACCGGCGAGAATGCAATGACCGCCAAGGTCGGCGAAACTGTCCTGATCATCCATTCGCAGGCTAACCGCGACACACGTCCTCACCTTATTGGCGGTCATGGCGAGTACGTATGGGCGACCGGCAAGTTTCACAACGTGCCGGACATCGATCAGGAAACCTGGTTCATACCGGGCGGCACGGCAGGCGCGGCAGTCTACACCTTCGCTCAGCCGGGCATATACGCCTACGTGAACCACAACCTGATCGAGGC
2009-11-17 B03a 001D ATCATGGTGCTGCCGCGTGACGGCCTGAAGGATGAGAAGGGCAAGCTCGTCCGCTACGATCGCATCTACTATATCGGCGAGAACGACTTCTATATCCCGCGCGACGAGCAGGGGAAATTCAAGAAGTACGACTCGGCCGGCGACAACTACGACGACACAGTGAAGGTGATGCGCGGCCTGATCCCGACGCATGTCGTGTTCAACGGCAAGGCTGGATCGCTGACCGGCGAACACGCCATGAAGGCCAAGGTTGGGGAAACGGTGCTGATCGTCCATTCTCAGGCAAATCGCGACACCCGCCCGCACCTGATCGGCGGCCACGGCGACTTCGTCTGGGAGGGCGGCAAGTTCGCGAACCCGCCCGCCAAGGATATGGAAACCTGGTTCATTCGCGGCGGTTCGGCGGGCGCGGCGGTCTATACCTTCCGGCAGCCCGGCGTCTACGCCTACGTCAACCACAACCTGATCGAGGC
2009-11-17 B03a 001E ATCATGGTGCTGCCGCGTGAAGGTCTCAAGGACGGTAACGGCAATCCACTGGCGTATGACCATGTCTACTACGTCGGTGAGCAGGACTTCTATGTACCCAGGGACGCTGACGGGAATTTCAAGACTTACGAGTCGCCCGGCGACGGCTATGCCGACATGCTCGAGGTCATGAAGACTCTGACTCCAACCCACGAAGTGTTCAATGGCGCGGTGGGTGCTCTCACTGGCGAGAACGCGATGACGGCCAATGTCGGCGAGACGGTGCTCATCATTCACTCGCAGGCGAACCGCGACACGCGGCCTCACCTGATCGGCGGACATGGCGACTACGTGTGGAACACGGGCAAGTTCCACAATGCCCCCGAGGTGGACCTCGAGACCTGGCACATCCCGGGCGGTTGCGCCGGGGCCGCGCTCTATACCTTCCTGCAGCCAGGCGTCTACGCCTACGTCAACCACAACCTGATCGAGGC
2009-11-17 B03a 001F ATCATGGTGCTGCCGCGCGACGGGCTGAAGGATGGCGAGGGCAAGCCGCTGCACTACGACAAGATCTTCTACATCGGCGAGAATGATTTCTACGTGCCGAAGGACGAGAACGGAAAGTACAGGACCTACGAGACGCTGGGCGAATCCTTCGCCGATACGACCGAGGTCATGCGCAAGCTGATTCCGACTCATGTCGTTTTCGAGGGGCGTGCCGGTGCGTTGACAGGCAAGAACGCGCTCAACGCCAAGGTCGGCGAAACCGTGATGATTGTGCATTCCGAGGCGAACCGCGACACCCGCCCGCATCTGATCGGCGGTCATGGCGACTATGTCTGGGAGACCGGCAAGTTCAGCAACCCGCCACAGAAGGATCTCGAGACGTGGTTCGTGCGGGGCGGCTCGGCGGGCGCGGCGCTCTACACCTTCCGCGAGCCCGGCATCTACGCCTATGTGAACCACAACCTGATCGAGGC
2009-11-17 B03a 001B ATCATGGTGCTGCCGCGCGAAGGCCTGAAGAACGATAAGGGCCAACCGGTCCGTTACGACAAGGTCTTCTATATCGGCGAGAATGACTTCTATGTTCCGCGCGACGAGAAAGGCGCCTTCAAGAAATACGAATCGCCCGGCGATGCCTATACCGATACGGTTGCGGTCATGAAGGGTTTGATCCCGACACATGTCGTCTTCAACGGCGCCAAGGGATCGCTGACCGGCGACAAGGCGATGAAGAGCACTGTCGGCGAAACCGTGCTGATCATCCATTCGCAAGCCAATCGCGATACCCGCCCGCATCTGATCGGCGGCCATGGCGACTATGTCTGGGAAGAAGGCAAATTCAACAATCCGCCCATCAAGGACCTTGAGACCTGGTTCATCCGCGGCGGCTCGGCTGGCGCTGCTCTCTACACCTTCCTGCAGCCTGGCGTTTACGCCTATGTAAACCACAACCTGATCGAGGC
Back to Data Catalog   EML formatted metadata