Methanotroph pmoA Gene Sequences

Methanotroph pmoA gene sequences extracted from soils of the Main Cropping System Experiment. The number of pmoA (particulate methane monooxygenase subunit A) Operational Taxonomic Units (OTUs) is used to measure the diversity of methanotrophs in a given site. The number of pmoA OTUs was determined by creating clone libraries for pmoA, clustering the sequences at 94% similarity for an OTU and counting the number of OTUs for each site. The number of pmoA OTUs indicates the diversity of methanotrophs at a given site. Sequencing was done through MSU GTSF (Genomics Technology Support facility).

This datatable is part of the Soil Microbial Gene Sequences dataset. Gene sequences extracted from soils.

Note

Experiment: Main Cropping System Experiment (MCSE)
Data available from: December 2004 to September 2009
Dataset: KBS082
Datatable ID: KBS082-003.18
Core Areas Populations,Disturbance
Related Tables:
Personnel:
Last Updated 2017-10-24
Status
  • Completed
Variate Description Units
sample date date the sample was collected
treatment treatment that was sampled
replicate replicate plot that was sampled
primer set primer set used
sequencing method sequencing method used
gene gene studied
pubmed id accession number to the pubmed database
accession accession id to the genebank database
name lab name of the sequence
note comments or notes
sequence gene sequence

Data Excerpt

sample_date treatment replicate primer_set sequencing_method gene pubmed_id accession name notes sequence
2008-12-01 T1 1 A189-A682 Sanger pmoA K1AB0002 ATCGATTGGAAGGATCGGCAATTTTGGGTAACGGTCACACCGATCGTAGAGGTGATGTATCCCGGTGCGATCATGTACTATTTTTGGACGTTTTACCGGCAACCGTTTGGTGCAACATTAAGTATCACAGGGCTACTCGTCGGAAAGTGGATTACCATTATATTCGCCTGGTACTGGTGGGCTAATTTCCCCGCAAACTTTGTGATGCCTGCCACTATGGTATCCAGTGCATTGATCCTCGATGCCACCCTGCTCTTGACAAGGAGCTGGATGCTCACCGCGATCTTCGGAGTATGGGCATTTGCGATGATGTTTAACCCGACACAATACGCACTATTCGGATACAGTCATCAGCCAGTCGTAGTGGACGGGCAGCTGATGTCACTGGCCGACTACATGGGATTCACCTTTGTCCGTACAGGAACGCCAGAGTATATCCGGATCATCGAGGTGGGTTCGCTCCGTACATTCGGTGGACACACCGTCTGGATCTCA
2008-12-01 T1 1 A189-A682 Sanger pmoA K1AB0009 ATCGATTGGAAGGATCGGCAATTTTGGGTAACGGTCACACCGATCGTAGAGGTGATGTATCCCGGTGCGATCATGTACTATTTTTGGACGTTCTATCGGCAACCGTTTGGTGCAACATTAAGTATCACAGGGCTACTCGTCGGAAAGTGGATTACCATTATATTCGCCTGGTACTGGTGGGCTAATTTCCCCGCAAACTTTGTGATGCCTGCCACTATGGTATCCAGTGCATTGATCCTCGATGCCACCTTGCTCTTGACAAGGAGCTGGATGCTCACCGCGATCTTCGGAGTATGGGCATTTGCGATGATGTTTAACCCGACACAATACGCACTATTCGGATACAGTCATCAGCCAGTCGTAGTGGACGGGCAGCTGATGTCACTGGCCGACTACATGGGATTCACCTTTGTCCGTACAGGAACGCCAGAGTATATCCGGATCATCGAGGTGGGTTCGCTCCGTACATTCGGTGGACACACCGTCTGGATCTCA
2008-12-01 T1 2 A189-A682 Sanger pmoA K1AB0013 ATCGATTGGAAGGATCGGCAGTTCTGGGTAACGGTCACACCAATTGTAGAAGTGATGTATCCCGGTGCGATCATGTATTACTTCTGGACATTCTACCGGCAACCGTTCGGTGCTACGTTGAGCATCACGGGACTACTTGTCGGAAAGTGGATTACAATTGTATTTGCTTGGTACTGGTGGGCCAATTTCCCAGCAAACTTCGTTATGCCAGCCACCATGGTCTCCAGTGCATTGATTCTTGACTGTACCCTTTTGCTGACTCGGAGCTGGATGCTCACGGCAATATTCGGGGTATGGGCATTTGCAATGATGTTTAACCCCACACAATACGCCCTGTTCGGATACAGCCACCAACCGGTGGTCGTGGACGGTCAGCTCCTTTCGCTGGCCGACTACATGGGCTTCACCTTTGTTAGGACCGGGACGCCTGAATATATCCGTATCATCGAGGTGGGATCGCTGCGTACGTTCGGCGGACACACCGTCTGGATCTCG
2008-12-01 T1 2 A189-A682 Sanger pmoA K1AB0016 ATCGATTGGAAGGATCGGCAGTTCTGGGTAACGGTCACACCAATTGTAGAAGTGATGTATCCCGGTGCGATCATGTATTACTTCTGGACATTCTACCGGCAACCGTTCGGTGCTACGTTGAGCATCACGGGACTACTTGTCGGAAAGTGGATTACAATTGTATTTGCTTGGTACTGGTGGGCCAATTTCCCAGCAAACTTCGTTATGCCAGCCACCATGGTCTCCAGTGCATTGATTCTTGACTGTACCCTTTTGCTGACTCGGAGCTGGATGCTCACGGCAATATTCGGGGTATGGGCATTTGCAATGATGTTTAACCCCACACAATACGCCCTGTTCGGATACAGCCACCAACCGGTGGTCGTGGACGGTCAGCTCCTTTCGCTGGCCGACTACATGGGCTTCACCTTTGTTAGGACCGGGACGCCTGAATATATCCGTACCATCGAGGTGGGA---------------------------------------
2008-12-01 T1 2 A189-A682 Sanger pmoA K1AB0017 ATCGATTGGAAGGATCGGCAGTTCTGGGTAACGGTCACACCAATTGTAGAAGTGATGTATCCCGGTGCGATCATGTATTACTTCTGGACATTCTACCGGCAACCGTTCGGTGCTACGTTGAGCATCACGGGACTACTTGTCGGAAAGTGGATTACAATTGTATTTGCTTGGTACTGGTGGGCCAATTTCCCAGCAAACTTCGTTATGCCAGCCACCATGGTCTCCAGTGCATTGATTCTTGACTGTACCCTTTTGCTGACTCGGAGCTGGATGCTCACGGCAATATTCGGGGTATGGGCATTTGCAATGATGTTTAACCCCACACAATACGCCCTGTTCGGATACAGCCACCAACCGGTGGTCGTGGACGGTCAGCTCCTTTCGCTGGCCGACTACATGGGCTTCACCTTTGTTAGGACCGGGACGCCTGAATATATCCGTATCATCGAGGTGGGATCGCTGCGTACGTTCGGCGGACACACCGTCTGGATCTCG
Back to Data Catalog   EML formatted metadata